sábado, 27 de junio de 2009

Un libro poco lúcido


Me encanta leer los libros que me regalan porque ya tengo la certeza de que puedo discutirlo con alguién. En este caso leí La cámara lúcida (La chambre claire) de Roland Barthes (Cherburgo, 12 de noviembre de 1915 – París, 25 de marzo de 1980). Es el primer libro que leo de este autor. Sabía que me iba gustar leerlo para desmenuzarlo y criticarlo como se merece. Como sospechaba, Barthes, como muchos filósofos del siglo XX cae en la tentación de hablar de un tema que desconoce. En todo el libro Barthes no comenta ninguna fotografía sacada por él, ni dice haber obturado alguna vez una cámara. Entonces pienso que interesante un libro sobre fotografía escrito por una persona que pareciera nunca saco una fotografía y que además vivió toda su vida con su madre. Como Barthes se dedica al estudio de los símbolos, la semiótica, voy a inferir que esto es otro símbolo de la decadencia filosófica en el siglo XX. Ni hablar que cita en este libro a otro libro del autor, llamado Roland Barthes por sí mismo, una autobiografía que nos llega como otro símbolo de su humildad y modestia. El problema que yo encontré es que como libro de filosofía es pobre porque el autor busca en su escrito hacer una fusión de conceptos filosóficos, literarios (con citas a Proust incluidas) y autobiográficos. El resultado final entonces es poco nutritivo en los tres aspectos y transmite una suerte de sensación onanista fotografica amateur.

La cámara lúcida se centra en una análisis poco superficial de tema, del cual yo también soy lego. Si principal tesis es que en la fotografía se trata de la búsqueda del Esto-a-sido. Podemos comentar que no siempre la fotografía es realista porque se puede buscar hacer una fotografía surrealista o retocada con herramientas de post-producción. Esto contradice la tesis de Barthes.

Recorramos brevemente algunas de las gemas literarias con las que nos hace reír Barthes. Enfaśis incluidos en el original.

[..] si la fotografía se convierte entonces en algo horrible es porque certifica, por decirlo así, que el cádaver es algo viviente, en tanto que cadaver, es la imagen viviente de una cosa muerta.


(Pág. 124)

Suele decir que fueron los pintores quienes inventaron las Fotografía [..] Yo afirmo: no, fueron los químicos.


(Pág. 126)

[..] muchos dicen que es el azúcar es dulce, pero yo encuentro el azúcar violento [..]


(Pag. 141)

[..] la Foto [..] como un organismo viviente, nace a partir de los granos de plata que germinan [..]


(Pág. 143) El fragmento que sigue es muy deprimente, suicidas abstenerse.

Antes la única foto en la que veo juntos a mi padre y a mi madre [..] es el amor como tesoro lo que va a desaparecer para siempre jamás; pues cuando yo ya no esté aquí, nadie podra testimoniar sobre aquel amor [..]


(Pág. 145)

La Fotografía es llana en todos los sentidos del término [..]


(Pág. 160)

[..] la mirada es siempre virtualmente loca: es al mismo tiempo efecto de verdad y efecto de locura.


Los dejo con Roland Barthes, su fotografía y su madre.

martes, 9 de junio de 2009

BioBricks, Syntetic Biology and Future Security Challenges!


Synthetic Biology is the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes. BioBrick is a standard specification being recently developed to specify bio-molecular parts, that is, the building blocks of molecular biology. These DNA bricks are contained inside plasmids, that are circular strings of DNA copied inside bacteria. The even have an open repository were everyone can upload their own parts and share them with other researchers.

For example here I retrieved the DNA that encodes a device for generating insulin (when present in the form of a plasmid inside bacteria?).


>BBa_I761007 Part-only sequence (600 bp)
tcccttgcatttacattttgaaacatctatagcgataaatgaaacatctt
aaaagttttagtatcatattcgtgttggattattctgcatttttggggag
aatggacttactagagaaagaggagaaatactagatggacaaattcgacg
ctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgcc
atcctgccgacccctgcgtttgcaggcattgtggaacaatgctgtaccag
catctgctccctctaccagctggagaactactgcatactagagaaagagg
agaaatactagatggacaaattcgacgctaatcgccgcaaattgctggcg
cttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgc
atttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacctaataatac
tagagtcacactggctcaccttcgggtgggcctttctgcgtttatatact
agagagagaatataaaaagccagattattaatccggcttttttattattt


Browse the complete bioparts catalogue here.

Some (futurologist?) security challenges that arose in their yet immature engineering projects are the possibility of malicious contributors injecting spoofed genetic materials to produce illegal drugs, poisonous substances or even dangerous viruses. Even some companies now are providing services to produce DNA at your command, you upload the nucleotide sequence via Internet and they send you the DNA packaged like Amazon, read this, circa 2004, EETimes article.