martes, 9 de junio de 2009

BioBricks, Syntetic Biology and Future Security Challenges!


Synthetic Biology is the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes. BioBrick is a standard specification being recently developed to specify bio-molecular parts, that is, the building blocks of molecular biology. These DNA bricks are contained inside plasmids, that are circular strings of DNA copied inside bacteria. The even have an open repository were everyone can upload their own parts and share them with other researchers.

For example here I retrieved the DNA that encodes a device for generating insulin (when present in the form of a plasmid inside bacteria?).


>BBa_I761007 Part-only sequence (600 bp)
tcccttgcatttacattttgaaacatctatagcgataaatgaaacatctt
aaaagttttagtatcatattcgtgttggattattctgcatttttggggag
aatggacttactagagaaagaggagaaatactagatggacaaattcgacg
ctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgcc
atcctgccgacccctgcgtttgcaggcattgtggaacaatgctgtaccag
catctgctccctctaccagctggagaactactgcatactagagaaagagg
agaaatactagatggacaaattcgacgctaatcgccgcaaattgctggcg
cttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgc
atttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacctaataatac
tagagtcacactggctcaccttcgggtgggcctttctgcgtttatatact
agagagagaatataaaaagccagattattaatccggcttttttattattt


Browse the complete bioparts catalogue here.

Some (futurologist?) security challenges that arose in their yet immature engineering projects are the possibility of malicious contributors injecting spoofed genetic materials to produce illegal drugs, poisonous substances or even dangerous viruses. Even some companies now are providing services to produce DNA at your command, you upload the nucleotide sequence via Internet and they send you the DNA packaged like Amazon, read this, circa 2004, EETimes article.

No hay comentarios:

Publicar un comentario